View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_94 (Length: 228)
Name: NF2125_high_94
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 56313772 - 56313572
Alignment:
| Q |
13 |
cagagagtttcccgcagcagcatattgtactaggtgcctaggttgatgctgctgctgc---atcatcatcaatccttcttcctcttctgaacggtaatta |
109 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56313772 |
cagagagtttcccgcagctgaatattgtactaggtgcctaggttgatgctgctgctgctgcataatcatcaatccttcttcttcttctgaacggtaatta |
56313673 |
T |
|
| Q |
110 |
gtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttccttccattttgttaactatgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313672 |
gtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttccttccattttgttaactatgt |
56313573 |
T |
|
| Q |
210 |
g |
210 |
Q |
| |
|
| |
|
|
| T |
56313572 |
g |
56313572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University