View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_98 (Length: 217)
Name: NF2125_high_98
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 42602697 - 42602879
Alignment:
| Q |
15 |
caaagggaaggttcaatgcctcagcgaaaccagcaagcctgtctccagtttcattcagctcttgcttcgattcccccacgcctgtgattcgaacgtggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42602697 |
caaagggaaggttcaatgcctcagcgaaaccagcaagcctgtctccagtttcattcagctcttgcttcgattcccccacgcctgtgattcgaacgtggct |
42602796 |
T |
|
| Q |
115 |
tggaggattagttcttgatgctaaactttggaagaagctaggccattgtagtccttgctttatgtcgaagtcaataatgtgaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42602797 |
tggaggattagttcttgatgctaaactttggaagaagctaggccattgtagtccttgctttatgtcgaagtcaataacgtgaa |
42602879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 124
Target Start/End: Original strand, 37498132 - 37498202
Alignment:
| Q |
54 |
tgtctccagtttcattcagctcttgcttcgattcccccacgcctgtgattcgaacgtggcttggaggatta |
124 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||| |||| ||||| |||| || |||||||||||| |
|
|
| T |
37498132 |
tgtctccagtatcattcaactcttgcttcaattcccccaagcctatgatttgaacatgacttggaggatta |
37498202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University