View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_101 (Length: 233)
Name: NF2125_low_101
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 72 - 210
Target Start/End: Complemental strand, 45342084 - 45341946
Alignment:
| Q |
72 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342084 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
45341985 |
T |
|
| Q |
172 |
ttttgtcgttatgcgtaccgttactacaggattgggatt |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45341984 |
ttttgtcgttatgcgtaccgttattacaggattgggatt |
45341946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 24 - 77
Target Start/End: Complemental strand, 45342169 - 45342116
Alignment:
| Q |
24 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342169 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
45342116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University