View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_105 (Length: 224)
Name: NF2125_low_105
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_105 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 49412599 - 49412789
Alignment:
| Q |
11 |
tgaaatgaagaataaaaaagaggaaattattggactgaagtaaggaaaagttagtggttcgtagtttatgaatgtatgacccttcacacaatatatcctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412599 |
tgaaatgaagaataaaaaagaggaaattattggaatgaagtaaggaaaagttagtggttcgtagtttatgaatgtatgacccttcacacaatatatcctc |
49412698 |
T |
|
| Q |
111 |
attccctacacattatgaagtttagctacataaatttgggggagaagatgaaattgtgaaaaaccatatagttgaagaagaatattctagg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49412699 |
attccctacacattatgaagtttagctacataaatttgggggagaagatgaaattgtgaaaaaccatatagttgaagaagaaaattctagg |
49412789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University