View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_106 (Length: 218)
Name: NF2125_low_106
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_106 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 37 - 200
Target Start/End: Complemental strand, 43149318 - 43149155
Alignment:
| Q |
37 |
atttatatttaagattggatagagtatgacatattcttatgaatatacaagagctcgatgaataagcaaagctccctcctacctatttgnnnnnnnnnnn |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43149318 |
atttatatttaagattggatagagtatgacatattcttatgaatatacaagagctcgatgaataagcaaagctccctcctacctatttgtttttactttt |
43149219 |
T |
|
| Q |
137 |
nnnctactgtctagattgaaactataaatgttgagactatttgtagacaaatagatacaggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43149218 |
tttctactgtctagattgaaactataaatgttgagactatttgtagacaaatagatacaagtgg |
43149155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University