View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_51 (Length: 312)
Name: NF2125_low_51
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 76 - 300
Target Start/End: Original strand, 1840908 - 1841142
Alignment:
| Q |
76 |
cactaaaaatagtataagtctagttttgaccatttaatagagtattataggttttgacgtttatggaactatatttaaatttagggaaatgttaacttgt |
175 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1840908 |
cactaaaaatagtataagtccagttttgaccatttaatagagtattataggttttaacgtttatggaactatatttaaatttagggaaatgttaacttgt |
1841007 |
T |
 |
| Q |
176 |
gttaataaatcaaatataaaaatag----------aattaagttgaaatcaacaatttccaatgcatttctttgttgctgacgaattaactgagacaata |
265 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1841008 |
gttaataaatcaaatataaaaatagtttatagaattattaagttgaaatcaacaatttccaatgcatttctttgttgctgacgaattaactaagacaata |
1841107 |
T |
 |
| Q |
266 |
atattggttgtaagacctaattatatgtagatatt |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1841108 |
atattggttgtaagacctaataatatgtagatatt |
1841142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University