View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_67 (Length: 262)
Name: NF2125_low_67
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 26 - 244
Target Start/End: Original strand, 16569865 - 16570084
Alignment:
| Q |
26 |
taaaacgcaaaagaataatcttggcatgcctagaaatatgataacaaactatagcttatatattgtattctttttt-ggctaataaagaataatctagta |
124 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16569865 |
taaaacgcaaaagttcaatcttggcatgactagaaatatgataacaaactatagcttatatattgtattctttttttggataataaagaataatctagta |
16569964 |
T |
 |
| Q |
125 |
tactttataaggtgaccatcctgaaatattatgatggctttagatccattactttataccctctcacactgcaatgtttcccttttcaaacatccacctg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16569965 |
tactttataaggtgaccatcctgaaatattatgatggctttagatccattactttataccctctcacactgcaatgtttccctcctcaaacatccacctg |
16570064 |
T |
 |
| Q |
225 |
tccagtactgcttgcccaat |
244 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
16570065 |
tccagtactgcttgcccaat |
16570084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 42 - 126
Target Start/End: Complemental strand, 16654012 - 16653927
Alignment:
| Q |
42 |
aatcttggcatgcctagaaatatgataacaaactatagcttatatattgtattcttt-tttggctaataaagaataatctagtata |
126 |
Q |
| |
|
|||| ||||||| |||||||| ||||||| |||||||| ||||||||| |||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
16654012 |
aatcatggcatggctagaaatttgataaccaactataggttatatattatattctttctttggatgataaagaataatctagtata |
16653927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University