View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_71 (Length: 256)
Name: NF2125_low_71
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 28716870 - 28716634
Alignment:
| Q |
1 |
ccgccttaatctagcaggggaagccggaaaattaagccatttctttacattttcaaaggaccctttttctggagtactgttctctgcagctgatagactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716870 |
ccgccttaatctagcaggggaagccggaaaattaagccgtttctttgcattttcaaaggaccctttttctggagtactgttctctgcagctgatagactt |
28716771 |
T |
|
| Q |
101 |
ggcaacctggacttggcttttgcagacttagttggcaccatgtaactaggaaccgatggagagcttgcaagactttcatcatcgctcactattgatccag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716770 |
tgcaacctggacttggcttttgcagacttagttggcaccatgtaactaggaaccgatggagagcttgcaagactttcatcatcgctcactattgatccag |
28716671 |
T |
|
| Q |
201 |
caaaggagtacctcatctgagtcgggtaggattggca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716670 |
caaaggagtacctcatctgagtcgggtaggattggca |
28716634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 28710794 - 28710589
Alignment:
| Q |
9 |
atctagcaggggaagccggaaaattaagccatttctttacattttcaaaggaccctttttctggagtactgttctctgcagctgatagacttggcaacct |
108 |
Q |
| |
|
|||| ||||| |||||||| || ||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
28710794 |
atctggcaggagaagccgggaagttaagccgtttctttgcatttccaaaggaccctttttctggagtactgttctctgcagctgatggactttgcaacct |
28710695 |
T |
|
| Q |
109 |
ggacttggcttttgcagacttagttggcaccatgtaactaggaaccgatggagagcttgcaagactttcatcatcgctcactattgatccagcaaaggag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28710694 |
ggacttggcttttgcagacttagttggcaccatgtaacttggaacagctggagagcttgcaagactttcatcatccctcactattgatccagcaatggag |
28710595 |
T |
|
| Q |
209 |
tacctc |
214 |
Q |
| |
|
| |||| |
|
|
| T |
28710594 |
tgcctc |
28710589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 183
Target Start/End: Original strand, 40609244 - 40609311
Alignment:
| Q |
116 |
gcttttgcagacttagttggcaccatgtaactaggaaccgatggagagcttgcaagactttcatcatc |
183 |
Q |
| |
|
||||| ||||| | ||| |||||||| ||||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
40609244 |
gctttcgcagattgagtcggcaccatataacttggaactgatggagagctagcaagactttcatcatc |
40609311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University