View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_74 (Length: 253)
Name: NF2125_low_74
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 26 - 243
Target Start/End: Complemental strand, 10590358 - 10590141
Alignment:
| Q |
26 |
actaataatagaaatgcaaaattatgtagcaaactatttccttcaaaaacacaaacattggatggatttggccatggcatgtggctcacaagcaccaatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10590358 |
actaataatagaaatgcaaaattatgtagcaaactatttccttcaaaaacacaaacattggatggatttggccatggcaagtggctcacaagcaccaatt |
10590259 |
T |
 |
| Q |
126 |
gttagaaattaaatcaagaaatggctagactagtgtcatagaagattgaattgctaccatttttatcattaagaaaatttattattgggccaaaataaag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10590258 |
gttagaaattaaatcaagaaatggctagactagtgttatagaagattgaattgctaccatttttatcattaagaaaatttattattgggccaaaataaag |
10590159 |
T |
 |
| Q |
226 |
tagtaagaaccacctatg |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10590158 |
tagtaagaaccacctatg |
10590141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University