View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_86 (Length: 246)
Name: NF2125_low_86
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 38609326 - 38609099
Alignment:
| Q |
1 |
tgtgtttattgcaaatataagttctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609326 |
tgtgtttattgcaaatataagttctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaa |
38609227 |
T |
|
| Q |
101 |
aatttgtatttaaacaacatgtttcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgaggcacattgctctttgtttgt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38609226 |
aatttgtatttaaacaacatgttccgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgagtcacattgctctttgtttgt |
38609127 |
T |
|
| Q |
201 |
gtgtcatatattattcgtaggttcaggt |
228 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
38609126 |
gtgtcatatattatttgtaggttcaggt |
38609099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 38609369 - 38609304
Alignment:
| Q |
24 |
ctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609369 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
38609304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 24 - 175
Target Start/End: Complemental strand, 38604267 - 38604116
Alignment:
| Q |
24 |
ctatgatatctctctaccgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatttgtatttaaacaacatgtt |
123 |
Q |
| |
|
||||||| |||||||| | ||||| ||| || |||||||||||| |||| |||||| |||||| ||||||||||||||| | ||| ||| |||||||||| |
|
|
| T |
38604267 |
ctatgatgtctctctatcctctctctgtgaaacttgtttgcattttgttaattgcagatataatttaatttcttcaaaactagtaattagacaacatgtt |
38604168 |
T |
|
| Q |
124 |
tcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttat |
175 |
Q |
| |
|
| ||| |||||||||| |||||| ||||| | |||| ||||||| ||||| |
|
|
| T |
38604167 |
ttagagggataaaatgatcttaggtcattgtattgtcaatttatcatgttat |
38604116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University