View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_87 (Length: 246)
Name: NF2125_low_87
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 20822997 - 20823136
Alignment:
| Q |
1 |
tgagacattgaagttttctaaagattttaagtttgattctctccgacatcaattttagtagtctaaattgagttctt-acnnnnnnnccttacattctct |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
20822997 |
tgagacattgaagtcttctaaagattttaagtttgattctctccgacatcaattttagtagtctagtttgagttcttaaaaaaaaaaccttacattctct |
20823096 |
T |
|
| Q |
100 |
acgaaaattataatacaatgttcgcaatagcaatgacctt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20823097 |
acgaaaattataatacaatgttcgcaatagcaatgacctt |
20823136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 175 - 231
Target Start/End: Original strand, 20823134 - 20823190
Alignment:
| Q |
175 |
cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatca |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20823134 |
cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatca |
20823190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University