View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_low_98 (Length: 238)
Name: NF2125_low_98
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 31727395 - 31727183
Alignment:
| Q |
18 |
tcataaagatacagacattaaacacaacactgatatgtcgagactaataataactctagaaacttaatgtaatcacgtgtcggtgtcaagccattgtcgg |
117 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31727395 |
tcataaagatacagacaccaaatacaacactgatatgtcgagactaataataactctagaaacttaatgtaatcacatgtcggtgtcaagccattgtcgg |
31727296 |
T |
 |
| Q |
118 |
acacttgcacatttggatgcgtcagacatcgaacacgtcttctatcagaagtgtcgtgctacgtagtatcagaaaaactaattactccaaggatttttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31727295 |
acacttgcacatttggatgcgtcaaacatcgaacacgtcttctatcagaagtgtcgtgctacgtggtatcagaaaaactaattactccaaggatttttaa |
31727196 |
T |
 |
| Q |
218 |
tgaatgatgatgt |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31727195 |
tgaatgatgatgt |
31727183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University