View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_high_15 (Length: 288)
Name: NF21260_high_15
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 48 - 269
Target Start/End: Original strand, 23523087 - 23523308
Alignment:
| Q |
48 |
ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523087 |
ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag |
23523186 |
T |
 |
| Q |
148 |
ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgcttgcttctgaggaaagatcaaatttgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523187 |
ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgcttgcttctgaggaaagatcaaatttgtg |
23523286 |
T |
 |
| Q |
248 |
gcatagtggacaaggagtacct |
269 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23523287 |
gcatagtggacaaggagtacct |
23523308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University