View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_high_18 (Length: 263)
Name: NF21260_high_18
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 47170390 - 47170138
Alignment:
| Q |
1 |
taaattaggttaggtttattacggaagagacatgggaatgggaaaacatacgacgagttcgacgacgtcgagggcggaagcattggatcggagagcagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170390 |
taaattaggttaggtttattacggaagagacatgggaatgggaaaacatacgacgagttcgacgacgtcgagggcggaagcattggatcggagagcagag |
47170291 |
T |
 |
| Q |
101 |
ataccgagattgagacattcggtaagaagctgtttggcttcttgctgacggtgtggtggcaggttaggatccacacctgcgccgccatgaacagcaatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47170290 |
ataccgagattgagacattcggtaagaagctgtttggcttcttgctgacggtgtggtgggaggttaggatccacacctgcaccgccatgaacagcaatag |
47170191 |
T |
 |
| Q |
201 |
cccaaccagacatgnnnnnnnctctcttgttttaaccttattttctctctgtg |
253 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47170190 |
cccaaccagacatgtttttttctctcttgttttaaccttattttctctctgtg |
47170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 35 - 208
Target Start/End: Original strand, 42165560 - 42165733
Alignment:
| Q |
35 |
ggaatgggaaaacatacgacgagttcgacgacgtcgagggcggaagcattggatcggagagcagagataccgagattgagacattcggtaagaagctgtt |
134 |
Q |
| |
|
|||||| |||||||||| || ||||| ||||| |||| || ||| ||||||| ||||||||| | || || | ||| ||||| | |||||||| |||| |
|
|
| T |
42165560 |
ggaatgagaaaacatacaacaagttcaacgacatcgacagcagaaccattggaacggagagcaaatatgccaatattaagacaatgagtaagaagttgtt |
42165659 |
T |
 |
| Q |
135 |
tggcttcttgctgacggtgtggtggcaggttaggatccacacctgcgccgccatgaacagcaatagcccaacca |
208 |
Q |
| |
|
||||||||| |||||| |||||||| || |||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
42165660 |
tggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatgcacagcaatagcccaacca |
42165733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University