View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_high_26 (Length: 227)
Name: NF21260_high_26
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 27 - 170
Target Start/End: Complemental strand, 35165781 - 35165638
Alignment:
| Q |
27 |
ggaacgtggttcacactacaactagatctaagctacgttgtaaatatccaacttgatgatcaaaaaacaaatttatgccaaggttgtagatctttgatcg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165781 |
ggaacgtggttcacactacaactagatctaagctaggttgtaaatatccaacttgatgatcaaaaaacaaatttatgccaaggttgtagatctttgatcg |
35165682 |
T |
|
| Q |
127 |
taaaagataaatgttgcccaactcctaaaatttggttatatttt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165681 |
taaaagataaatgttgcccaactcctaaaatttggttatatttt |
35165638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University