View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_17 (Length: 263)
Name: NF21260_low_17
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 246
Target Start/End: Original strand, 39944756 - 39944978
Alignment:
| Q |
24 |
agcatagctaatgaacaacatgaacacaatagatgggacagggttgagagtttctgcaataaatacctgataaaccaaggttattggatagataaaaaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944756 |
agcatagctaatgaacaacatgaacacaatagatgggacagggttgagagtttctgcaataaatacctgataaaccaaggttattggatagataaaaaga |
39944855 |
T |
 |
| Q |
124 |
caagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagatacaacaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944856 |
caagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagatacaacaaa |
39944955 |
T |
 |
| Q |
224 |
aggtggttacgcttgtcctgatt |
246 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39944956 |
aggtggttacgcttgtcctgatt |
39944978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 98 - 219
Target Start/End: Original strand, 39949175 - 39949296
Alignment:
| Q |
98 |
ccaaggttattggatagataaaaagacaagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggc |
197 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||| ||||| |||||||| |||||||| ||| |
|
|
| T |
39949175 |
ccaaggtaattggattgataaaaagacaaaagaacaatccatggtagcagcaactgtaatcgcaacaatgacatttcaatcagtaataagtccaccaggc |
39949274 |
T |
 |
| Q |
198 |
ggtgtttggcaagaagatacaa |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39949275 |
ggtgtttggcaagaagatacaa |
39949296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 147 - 218
Target Start/End: Complemental strand, 29671593 - 29671522
Alignment:
| Q |
147 |
gcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagataca |
218 |
Q |
| |
|
|||||||| ||||| || ||||||||||| || | ||| |||||||| || ||||||||||||||| ||||| |
|
|
| T |
29671593 |
gcaactgtaattgccacaatgacttttcaatccgcaataagtccaccaggtggtgtttggcaagaaaataca |
29671522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University