View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_21 (Length: 253)
Name: NF21260_low_21
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 45165830 - 45166065
Alignment:
| Q |
1 |
ttactggaagaaaaccaatgcataatatgtcctcagatcaatatcaatctctggttacatgggtatgtattattattacataatggagaaaatggatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45165830 |
ttactggaagaaaaccaatgcataatatgtcctcagatcaatatcaatctctggttacatgggtatgtattattattacataatggagaatatggatgaa |
45165929 |
T |
|
| Q |
101 |
aatttaagttttgctgtactttatggtttaagactttcaaattcaatatgtaggccatgcctcagctaaccgacagatcaaagcttccaagtattctaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165930 |
aatttaagttttgctgtactttatggtttaagactttcaaattcaatatgtaggccatgcctcagctaaccgacagatcaaagcttccaagtattctaga |
45166029 |
T |
|
| Q |
201 |
tcctgttatccaaaatacaatggatttgaagcattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166030 |
tcctgttatccaaaatacaatggatttgaagcattt |
45166065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University