View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_22 (Length: 250)
Name: NF21260_low_22
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 45341400 - 45341170
Alignment:
| Q |
18 |
gtgtgctgctttaaaaaatatatattgaagggtatattgannnnnnnnnnnnnnnngtgaaaacttaatttattagtagtgttttgtcacagtgtagtgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
45341400 |
gtgtgctgctttaaaaaatatatattgaagggtatattgattttgtttttatttttgtgaaaacttaatttattagtagtgttttgtca----gt-gtgt |
45341306 |
T |
 |
| Q |
118 |
atccttattttggtacataaatgggttgtttatgttgttcattgatgcact---ctaccactagaacattagcaatagtttgttttgttacttnnnnnnn |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341305 |
atccttattttggtacataaatgggttgtttatgttgttcattgatgcactctactaccactagaacattagcaatagtttgttttgttacttaaaaaaa |
45341206 |
T |
 |
| Q |
215 |
taaatacaaaggtgtagtttattatagtacagtagt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45341205 |
taaatacaaaggtgtagtttattatagtatagtagt |
45341170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University