View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_27 (Length: 209)
Name: NF21260_low_27
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 15 - 107
Target Start/End: Complemental strand, 10005895 - 10005803
Alignment:
| Q |
15 |
cagagacgaaaactcatagaaaagtgatgggtttggttaagttacattgattggtggaacgtggaattggaaatcatcacttcccacgatgca |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10005895 |
cagagacgaaaacttatagaaaagtgatgggtttggttaagttacattgattggtggaatgtggaattggaaatcatcacttcccacgatgca |
10005803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 107
Target Start/End: Complemental strand, 16755395 - 16755322
Alignment:
| Q |
34 |
aaaagtgatgggtttggttaagttacattgattggtggaacgtggaattggaaatcatcacttcccacgatgca |
107 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
16755395 |
aaaagttatgggtttggctaagttacattgattagtggagtgtggaattggaaatcatcacttcacacaatgca |
16755322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 90
Target Start/End: Complemental strand, 16755457 - 16755419
Alignment:
| Q |
52 |
taagttacattgattggtggaacgtggaattggaaatca |
90 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
16755457 |
taagttacattgattagtggaatgtggaattggaaatca |
16755419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 44001557 - 44001462
Alignment:
| Q |
13 |
agcagagacgaaaactcatagaaaag-tgatgggtttggttaagttacattgattggtggaacgtggaattggaaatcatcacttcccacgatgca |
107 |
Q |
| |
|
||||||||| |||||| | ||||||| |||| |||||| |||||||||||||||| ||||| |||||| || ||||||||||||| ||||||||| |
|
|
| T |
44001557 |
agcagagacaaaaacttacagaaaaggtgatacgtttggctaagttacattgattgatggaatgtggaactgaaaatcatcacttcacacgatgca |
44001462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Original strand, 30774968 - 30775012
Alignment:
| Q |
48 |
tggttaagttacattgattggtggaacgtggaattggaaatcatc |
92 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30774968 |
tggttcagttacattgattggaggagtgtggaattggaaatcatc |
30775012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University