View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21260_low_7 (Length: 414)

Name: NF21260_low_7
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21260_low_7
NF21260_low_7
[»] chr7 (2 HSPs)
chr7 (151-398)||(45327857-45328104)
chr7 (1-64)||(45328191-45328254)


Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 151 - 398
Target Start/End: Complemental strand, 45328104 - 45327857
Alignment:
151 attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45328104 attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt 45328005  T
251 gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45328004 gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa 45327905  T
351 attactattgaagattggcttgctgctgatatcaacaatactggtttt 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
45327904 attactattgaagattggcttgctgctgatatcaacaatactggtttt 45327857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 45328254 - 45328191
Alignment:
1 aagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45328254 aagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa 45328191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University