View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_7 (Length: 414)
Name: NF21260_low_7
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 151 - 398
Target Start/End: Complemental strand, 45328104 - 45327857
Alignment:
| Q |
151 |
attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328104 |
attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt |
45328005 |
T |
 |
| Q |
251 |
gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328004 |
gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa |
45327905 |
T |
 |
| Q |
351 |
attactattgaagattggcttgctgctgatatcaacaatactggtttt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327904 |
attactattgaagattggcttgctgctgatatcaacaatactggtttt |
45327857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 45328254 - 45328191
Alignment:
| Q |
1 |
aagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328254 |
aagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa |
45328191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University