View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21260_low_9 (Length: 347)
Name: NF21260_low_9
Description: NF21260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21260_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 331
Target Start/End: Original strand, 2874941 - 2875250
Alignment:
| Q |
18 |
aataattgctagtgagttattagaagtctctttacgtatattttatgtcaatagaggttgctcaaacctggaccatgcataacaaccatctacacctggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2874941 |
aataattgctagtgagttattagaagtctctttacatatattttatgtcaatagaggttgctcaaacctggaccatgcataacaaccatctacacctagc |
2875040 |
T |
 |
| Q |
118 |
tgaacattctgtaaacctgnnnnnnnnnn-cttcctttcttatttgcattgctttttgaagagttgttgttcatgacctttgatttgagtatatgaaagc |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2875041 |
tgaacattctgtaaaccttttttttttcttcttcctttcttatttgcattgctttttgaagagttgttgttcatgacctttg-----agtatatgaaagc |
2875135 |
T |
 |
| Q |
217 |
gaaatgctaaagttaattagtggaaactagaagcgacaggtttatgttgctacttgatgatgtcaattatcatttaaggcttagtcaactggtaccacag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875136 |
gaaatgctaaagttaattagtggaaactagaagcgacaggtttatgttgctacttgatgatgtcaattatcatttaaggcttagtcaactggtaccacag |
2875235 |
T |
 |
| Q |
317 |
tgagttcagcttcat |
331 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2875236 |
tgagttcagcttcat |
2875250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University