View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21261_low_6 (Length: 264)
Name: NF21261_low_6
Description: NF21261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21261_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 55307764 - 55308006
Alignment:
| Q |
1 |
taatgatttttactttactggcattactgcataacaaattatgaaattgttcttaataaaacaattgtacgaaattgaactaaaacattgatatacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55307764 |
taatgatttttactttactggcattactgcataacaaattatgaaattgttcttaaaaaaacaattgtacgaaattgaactaaaacattgatatacataa |
55307863 |
T |
|
| Q |
101 |
aatacatggtttcttttcttttgtacgnnnnnnntaggaaaaatacttgactatttattttttcagtttttctgcataataatcccatttggtacgtatt |
200 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
55307864 |
aatacat-gtttcttttcttttgtatgaaaaaaataggaaaaatacttgactatttattttttcagtttttcttcataataatcccatttgatacttatt |
55307962 |
T |
|
| Q |
201 |
gttatcctagccagcaaatgtgaaacacagctctacatggattg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55307963 |
gttatcctagccagcaaatgtgaaacacagctctacatggattg |
55308006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University