View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21263_high_18 (Length: 239)
Name: NF21263_high_18
Description: NF21263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21263_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38710895 - 38710674
Alignment:
| Q |
1 |
gctaccggttggactgcccctacacattctccagcacaatcatcagcttggaatgctccgacaccaagtcctgccaacatacatgctccgactccaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38710895 |
gctaccggttggactgcccctacacattctccagcacaatcatcagcttggaatgctccgacaccaagtcctgccaacatacatgctccgactccaagtc |
38710796 |
T |
|
| Q |
101 |
caaccgacgaagatgctccaaaaccaagtgatattgacaatgactctccagctccatctcctggtcattcgggttctaggaggttgagtggttttgttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38710795 |
caaccgacgaagatgctccaaaaccaagtgatattgacaatgactctccagctccatctcctggtcattcgggttctaggaggttgagtggttttgttgg |
38710696 |
T |
|
| Q |
201 |
tgtgagtgttgtggtggctttg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38710695 |
tgtgagtgttgtggtggctttg |
38710674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 38710964 - 38710896
Alignment:
| Q |
1 |
gctaccggttggactgcccctacacattctccagcacaatcatcagcttggaatgctccgacaccaagt |
69 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| || ||||||| | |||||||||||||||||||||| |
|
|
| T |
38710964 |
gctaccggttggactgctcctgcacattctccaacaaaatcatcgggttggaatgctccgacaccaagt |
38710896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 38711033 - 38710965
Alignment:
| Q |
1 |
gctaccggttggactgcccctacacattctccagcacaatcatcagcttggaatgctccgacaccaagt |
69 |
Q |
| |
|
||||||||||||||| | || ||||| |||||| |||||||| | |||||| ||||||| |||||||| |
|
|
| T |
38711033 |
gctaccggttggactactccgacacactctccaacacaatcaccggcttggcatgctccttcaccaagt |
38710965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 218
Target Start/End: Complemental strand, 42094374 - 42094310
Alignment:
| Q |
154 |
ccatctcctggtcattcgggttctaggaggttgagtggttttgttggtgtgagtgttgtggtggc |
218 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
42094374 |
ccatctcctggtcattcgggctctacaaggttgagtggttctgttggtgtcaatgttgtggtggc |
42094310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 52798796 - 52798852
Alignment:
| Q |
166 |
cattcgggttctaggaggttgagtggttttgttggtgtgagtgttgtggtggctttg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
52798796 |
cattcgggttctaccaggttgagtggttctgatggtgttagtgttgtggtggctttg |
52798852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University