View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21263_high_24 (Length: 220)

Name: NF21263_high_24
Description: NF21263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21263_high_24
NF21263_high_24
[»] chr2 (5 HSPs)
chr2 (4-209)||(38711127-38711332)
chr2 (31-126)||(38710959-38711054)
chr2 (31-126)||(38711028-38711123)
chr2 (47-126)||(38710837-38710916)
chr2 (31-122)||(38710890-38710981)
[»] chr8 (2 HSPs)
chr8 (34-126)||(39704971-39705063)
chr8 (33-91)||(39704937-39704995)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 4 - 209
Target Start/End: Original strand, 38711127 - 38711332
Alignment:
4 cggtgattgtgttggagcagtcttgctggtagcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgata 103  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38711127 cggtgattgtgttggagcagtcttgctggtagcacttggtgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgata 38711226  T
104 gcacttggtgaaggagcattccatctagtagcacttggtgtcggagcaatccatgctggagacgttgctggggagtgtaccggtgcaacgaaaggtgatg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38711227 gcacttggtgaaggagcattccatctagtagcacttggtgtcggagcaatccatgctggagacgttgctggggagtgtaccggtgcaacgaaaggtgatg 38711326  T
204 atgatg 209  Q
    ||||||    
38711327 atgatg 38711332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 31 - 126
Target Start/End: Original strand, 38710959 - 38711054
Alignment:
31 ggtagcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcattcca 126  Q
    |||||||||||| |||||||| | |||||| |||||||||| ||| |||||||| |||| | |||||||| ||||||||||||||| |||| ||||    
38710959 ggtagcacttggtgaaggagcatgccaagccggtgattgtgttggagagtgtgtcggagtagtccaaccggtagcacttggtgaagaagcactcca 38711054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 31 - 126
Target Start/End: Original strand, 38711028 - 38711123
Alignment:
31 ggtagcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcattcca 126  Q
    |||||||||||| |||| |||  ||||||  |||||||||| |||||||||||  |||||| |||| ||| |||||||||||||||||||||||||    
38711028 ggtagcacttggtgaagaagcactccaagtcggtgattgtgttggggagtgtgcgggagcagtccagccggtagcacttggtgaaggagcattcca 38711123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 38710837 - 38710916
Alignment:
47 ggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcattcca 126  Q
    ||||| |||||||| | |||||||| ||| || ||||| || ||| |||||||| ||||||||||||  |||||||||||    
38710837 ggagcattccaagctgatgattgtgctggagaatgtgtaggggcagtccaaccggtagcacttggtgtcggagcattcca 38710916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 38710890 - 38710981
Alignment:
31 ggtagcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcat 122  Q
    |||||||||||| |  ||||| |||||| | | ||||| || ||| || ||||  |||||| |||||||| |||||||||||||||||||||    
38710890 ggtagcacttggtgtcggagcattccaacccgatgattttgttggagaatgtgcaggagcagtccaaccggtagcacttggtgaaggagcat 38710981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 39705063 - 39704971
Alignment:
34 agcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagcattccaaccgatagcacttggtgaaggagcattcca 126  Q
    |||||||| ||| ||||| |||||||| || ||||||  |||||||||||  |||||| ||||  | |||||||||||||| |||||||||||    
39705063 agcacttgacgagggagcattccaagctggcgattgtactggggagtgtgccggagcagtccagacaatagcacttggtgagggagcattcca 39704971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 91
Target Start/End: Complemental strand, 39704995 - 39704937
Alignment:
33 tagcacttggcgaaggagccttccaagcaggtgattgtgatggggagtgtgttggagca 91  Q
    |||||||||| || ||||| |||||||| |||| ||||| ||||||| |||||||||||    
39704995 tagcacttggtgagggagcattccaagctggtggttgtgttggggagcgtgttggagca 39704937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University