View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21263_low_21 (Length: 222)
Name: NF21263_low_21
Description: NF21263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21263_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 33 - 199
Target Start/End: Original strand, 33655469 - 33655635
Alignment:
| Q |
33 |
ttgatgaagggaaaatgatggtaatgaaactatgaggttcttctaatcttgtgttaagtcaaactatcgaaagaatcaactggtgggaggaattgattga |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33655469 |
ttgatgaagggaaaatgatggtaatgaaactatgaggttcttctaatcttgtgttaagtcaaactattgaaagaatcaactggtgggaggaattgattga |
33655568 |
T |
 |
| Q |
133 |
tggattggatgatatattaaggcagcgctgaagaggtttcttttatgaaactaactttaatacgagg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655569 |
tggattggatgatatattaaggcagcgctgaagaggtttcttttatgaaactaactttaatacgagg |
33655635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University