View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21263_low_21 (Length: 222)

Name: NF21263_low_21
Description: NF21263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21263_low_21
NF21263_low_21
[»] chr4 (1 HSPs)
chr4 (33-199)||(33655469-33655635)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 33 - 199
Target Start/End: Original strand, 33655469 - 33655635
Alignment:
33 ttgatgaagggaaaatgatggtaatgaaactatgaggttcttctaatcttgtgttaagtcaaactatcgaaagaatcaactggtgggaggaattgattga 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
33655469 ttgatgaagggaaaatgatggtaatgaaactatgaggttcttctaatcttgtgttaagtcaaactattgaaagaatcaactggtgggaggaattgattga 33655568  T
133 tggattggatgatatattaaggcagcgctgaagaggtttcttttatgaaactaactttaatacgagg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33655569 tggattggatgatatattaaggcagcgctgaagaggtttcttttatgaaactaactttaatacgagg 33655635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University