View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_high_15 (Length: 375)
Name: NF21265_high_15
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 13 - 361
Target Start/End: Original strand, 7874508 - 7874856
Alignment:
| Q |
13 |
tgtgtgcgttatagggattgcacgtattgtgtgtgaagggtaaaacagggacacgtgcatatgtatgcgtgcgtgtaacacactcgctggacggttacac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874508 |
tgtgtgcgttatagggattgcacgtattgtgtgtgaagggtaaaacagggacacgtgcatatgtatgcgtgcgtgtaacacactcgctggacggttacac |
7874607 |
T |
 |
| Q |
113 |
acgtccgggttcttttgcgcgtgtacacgcgactaacagttttatttttctaaaacgggtcagacccgcaactgacccgtttggatctctacggttacat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874608 |
acgtccgggttcttttgcgcgtgtacacgcgactaacagttttatttttctaaaacgggtcagacccgcaactgacccgtttggatctctacggttacat |
7874707 |
T |
 |
| Q |
213 |
ggttcagcacggcagaatactaaagcggttacggcaaacagaatacattgttttgcttgaatgaatattgcagtaaatnnnnnnntacatgaatcggaag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7874708 |
ggttcagcacggcagaatactaaagcggttacggcaaacagaatacattgttttgcttgaatgaatattgcagtaaatcaaaaaatacatgaatcggaag |
7874807 |
T |
 |
| Q |
313 |
cgttaatatcaaagaatcaagtcaatattggaatcaattgattttcatg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874808 |
cgttaatatcaaagaatcaagtcaatattggaatcaattgattttcatg |
7874856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University