View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_high_16 (Length: 324)
Name: NF21265_high_16
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 47493724 - 47494029
Alignment:
| Q |
1 |
aaaaatgagagcttcattttagtgattaaacagccaacatcatcctgacgaactcttgataatcaacgagaccgtcaccatccagatcagccgttttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47493724 |
aaaaatgagagcttcattttagtgattaaacagtcaacatcatcctgacgaactcttgataatcaacgaggccgtcaccatccagatcagccgttttgat |
47493823 |
T |
|
| Q |
101 |
catctgttccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttcaatatta |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47493824 |
catctgctccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttc---atta |
47493920 |
T |
|
| Q |
201 |
cggtacgacaaaacaaattatatatgttgaattaattatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaa |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47493921 |
cggtacaacaaaacaaattatatatgttgaattaattatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaa |
47494020 |
T |
|
| Q |
301 |
attcctctt |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
47494021 |
attcctctt |
47494029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University