View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_high_23 (Length: 249)
Name: NF21265_high_23
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 73 - 175
Target Start/End: Complemental strand, 25583322 - 25583220
Alignment:
| Q |
73 |
tgaaaaccgttttgggtttttgggattcaaagggaacgagagtggaagtaatagtgagaacgaaatatacaccattttcttccacttttcctaccattca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583322 |
tgaaaaccgttttgggtttttgggattcaaagggaacgagagtggaagtaatagtgagaacgaaatatacaccattttcttccacttttcctaccattca |
25583223 |
T |
 |
| Q |
173 |
tca |
175 |
Q |
| |
|
||| |
|
|
| T |
25583222 |
tca |
25583220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 25583356 - 25583317
Alignment:
| Q |
24 |
agaagaagaaagagagattgtggttagtacttactgaaaa |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583356 |
agaagaagaaagagagattgtggttagtacttactgaaaa |
25583317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 25593059 - 25592980
Alignment:
| Q |
18 |
agaaacagaagaagaaagagagattgtggttagtacttactgaaaaatgggaaggtgaaaaccgttttgggtttttggga |
97 |
Q |
| |
|
|||||||| |||||||||||| | ||||| | |||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25593059 |
agaaacagcagaagaaagagaagtactggttggcacttactggaaaatgggaaggtgaaaaccgttttggccttttggga |
25592980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University