View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_high_28 (Length: 230)
Name: NF21265_high_28
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 37108521 - 37108323
Alignment:
| Q |
15 |
agcaaagggtggttcaccaaaagcaagagttgcatcatacaaagtttgttggcctccaattaatggcgacgagtgctttgatgcagacatacttgcagca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108521 |
agcaaagggtggttcaccaaaagcaagagttgcatcatacaaagtttgttggcctccaattaatggcgacgagtgctttgatgcagacatacttgcagca |
37108422 |
T |
|
| Q |
115 |
tttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctgcttctaaccttttcaatgatagtgttgctattggatctttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108421 |
tttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctgcttctaaccttttcaatgatagtgttgctattggatctttc |
37108323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 146
Target Start/End: Original strand, 39188767 - 39188879
Alignment:
| Q |
34 |
aaagcaagagttgcatcatacaaagtttgttggcctccaattaatggcgacgagtgctttgatgcagacatacttgcagcatttgatgcagctatccatg |
133 |
Q |
| |
|
|||||||||||||| | |||||||| || ||||| |||||| ||||| ||| ||||||||||| || || | ||||| |||||| ||||| |||| |
|
|
| T |
39188767 |
aaagcaagagttgctgcttacaaagtctgctggccaccaattgatggcagcgaatgctttgatgctgatatcatggcagcctttgatatggctattcatg |
39188866 |
T |
|
| Q |
134 |
atggtgttgatgt |
146 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
39188867 |
atggggttgatgt |
39188879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University