View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_high_9 (Length: 432)
Name: NF21265_high_9
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 140 - 419
Target Start/End: Complemental strand, 54622230 - 54621951
Alignment:
| Q |
140 |
ctttatgcggttttgtttgtttttgcagggttcttcattccagaggccaattttgaatttgagaacaaacatttctgctccttactcacccggtattcta |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54622230 |
ctttatacggttttgtttgtttttgcagggttcttcattccagaggccaattttgaatttgagaacaaacatttctgctccttactcacccggtattcta |
54622131 |
T |
|
| Q |
240 |
ttcatcttcttccttaattactttactattttgttctctgctctttcaattcttgtggcaattgagtaattaacaaataattatgcaacatattttttgc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54622130 |
ttcatcttcttccttaattactttactattttgttctctgctctttcaattcttgtggcaattgagtaattaacaaagaattatgcaacatattttttgc |
54622031 |
T |
|
| Q |
340 |
ttcaatgctaatgcatgcaatgcaactaaatgtggagcttatgttcaactattattatgcaattatgtatgaataacatg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54622030 |
ttcaatgctaatgcatgcaatgcaactaaatgtggagcttatgttcaactattattatgcaattatgtatgaataacatg |
54621951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 4 - 145
Target Start/End: Original strand, 54622369 - 54622512
Alignment:
| Q |
4 |
agtctctctgaaagataaact--ttttatttggcgagagagagacttgtttggtgtgggacccaccaaatgtggacgcagatcgatagaccattgcagcc |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54622369 |
agtctctctgaaagataaactctttttatttggcgagagagagacttgtttggtgtgggacccaccaaatgtggacgcagatcgatagaccattgcagcc |
54622468 |
T |
|
| Q |
102 |
gcatgtatccattctttcgtaccttttcacttcactttctttat |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54622469 |
gcatgtatccattctttcgtaccttttcacttcactttctttat |
54622512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University