View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_low_15 (Length: 386)
Name: NF21265_low_15
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 139 - 367
Target Start/End: Complemental strand, 33526082 - 33525854
Alignment:
| Q |
139 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526082 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
33525983 |
T |
 |
| Q |
239 |
ctctagcaatgtcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatcaatgactt |
338 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525982 |
ctctagcaatatcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatcaatgactt |
33525883 |
T |
 |
| Q |
339 |
taaactttgccctttctttacatgtgttt |
367 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33525882 |
taaactttgccctttctttacatgtgttt |
33525854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 11 - 76
Target Start/End: Complemental strand, 33526211 - 33526145
Alignment:
| Q |
11 |
cagagaaaccaaa-tgatcataaaagattctaaacctggaaatttaatgttgaatttcccagttagc |
76 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33526211 |
cagagaaaccaaaatgatcataaaagattctaaacctgggaatttaatgttgaatttcccagttagc |
33526145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University