View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_low_19 (Length: 313)
Name: NF21265_low_19
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 33 - 161
Target Start/End: Complemental strand, 30683999 - 30683871
Alignment:
| Q |
33 |
ggatccaattgtagcttctcctttatatgaaatcataggcgcaagatctacaacttctccaatagattgtaatattatctgccgacatgataaataacca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683999 |
ggatccaattgtagcttctcctttatatgaaatcataggcgcaagatctacaacttctccaatagattgtaatattatctgccgacatgataaataacca |
30683900 |
T |
 |
| Q |
133 |
acagaacatcaatcccagatttcctcaag |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30683899 |
acagaacatcaatcccagatttcctcaag |
30683871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 199 - 292
Target Start/End: Complemental strand, 30683833 - 30683740
Alignment:
| Q |
199 |
gattaattttctagtttaaatattctttgtatttagttagttacagcagtgaagtttaactctctctagctagtgtaggttaaacacatagtat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
30683833 |
gattaattttctagtttaaatattctttgcatttagttagttacagtagtgaagtttaactctctccagctagtgtaggttaaacacacagtat |
30683740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University