View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_low_28 (Length: 244)
Name: NF21265_low_28
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 23 - 231
Target Start/End: Complemental strand, 40132341 - 40132133
Alignment:
| Q |
23 |
gatgcaatacagtgctagatagaaacattaatgctttttagcaatctacaatctatctatatgacatgaaatctcataaatatatatagtctttctcttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40132341 |
gatgcaatacagtgctagatagaaacattaatgctttttagcaatccacaatctatctatatgacatgaaatctcataaatatatatagtctttctcttt |
40132242 |
T |
 |
| Q |
123 |
cattccttctccatctatctatctaattctatagtgaaaacactttcatggagtccaatatacnnnnnnnngtacttctctttggtttcacttcattgat |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
40132241 |
cattccttctccatccatctatctaattctatagtgaaaacactttcatggagtccaatatacttttttttgtacttctcttcggtttcacttcattgat |
40132142 |
T |
 |
| Q |
223 |
tttcatctc |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
40132141 |
tttcatctc |
40132133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University