View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_low_31 (Length: 237)
Name: NF21265_low_31
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 25582984 - 25583145
Alignment:
| Q |
20 |
gccaccacatcgagatagattaattgagcttttatgtgcattgtcacagttgagtttaacccaattctctcggagtctcttcaatccaatccaatgaaaa |
119 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
25582984 |
gccaccacattgagatagattaactgagcttttatgtgcattgtcacaactgagtttaacccaactctctcggagtctctt-----ccatccaatgaaaa |
25583078 |
T |
 |
| Q |
120 |
acactttagagcaattgaattataataatt--nnnnnnnncactttagagcatttccctaattacaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25583079 |
acactttagagcaattgaattataataattaaaaaaaaaacactttagagcatttccctaattacaa |
25583145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 3243420 - 3243326
Alignment:
| Q |
15 |
agaaggccaccacatcgagatagattaattgagcttttatgtgcattgtcacagttgagtttaacccaattctctcggagtctcttcaatccaat |
109 |
Q |
| |
|
|||||||| ||||||| || ||||||| |||||||||||| || | ||||||||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
3243420 |
agaaggccgccacatcccgagagattaactgagcttttatgcgcgtcgtcacagttgagtttaacccagccctctcggggtctcttccatccaat |
3243326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 25376502 - 25376575
Alignment:
| Q |
36 |
agattaattgagcttttatgtgcattgtcacagttgagtttaacccaattctctcggagtctcttcaatccaat |
109 |
Q |
| |
|
||||||| |||||||||||| || | ||| ||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
25376502 |
agattaactgagcttttatgcgcgctatcaaagttgagtttaacccaaccctctcagagtctcttccatccaat |
25376575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University