View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21265_low_32 (Length: 236)
Name: NF21265_low_32
Description: NF21265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21265_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 5 - 218
Target Start/End: Complemental strand, 33233913 - 33233700
Alignment:
| Q |
5 |
atgcattagtagtgctgttcctcctttgcttacaattcttaaatcctccattcaataagaggggaggtgtagttgaaccaagaaagcttgtgtctctact |
104 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
33233913 |
atgcattagtagtgctgttactcctttgcttacaatttttaaatcctccatttaacaagaggggaggtgtagtggaaccaagaaagcttgtgtctttact |
33233814 |
T |
 |
| Q |
105 |
tactgcaaaccaaatattgctgtctgaatacatatcgtcaccgatttggaaggatatgctattaactttgccatctttgcttgatactcgtctaagatcg |
204 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233813 |
tattgcaaaccaaatattgccatctgaatacatttcatcaccgatttggaaggatatgctattaactttgccatctttgcttgatactcgtctaagatcg |
33233714 |
T |
 |
| Q |
205 |
agtatacattttga |
218 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33233713 |
agtatacattttga |
33233700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University