View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_high_23 (Length: 332)
Name: NF21266_high_23
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 52 - 322
Target Start/End: Complemental strand, 45708307 - 45708035
Alignment:
| Q |
52 |
ttatatttaacaattggaccatcaagattcaacttcaatttgcatattcgtttgacca---tttccttcttatagtaaggtagttctatcatataccatg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45708307 |
ttatatttaacaattggaccatcaagattcaacttcaatttgcatattcgtttgactactatttccttcttatcgtaaggtagttctatcatataccata |
45708208 |
T |
 |
| Q |
149 |
tttgatttatttcaatagcactcaactcactttccagtgttaactgctcatagcctcttctataatttattcagttatgatacatgtacatttatttggc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45708207 |
tttgatttatttcaatagcactcaactcactttcca-tgttaactgctcatagcctcttctataatttattcagttatgatacatgtacatttatttggc |
45708109 |
T |
 |
| Q |
249 |
aaacatttctcctttagaatatcttttaggctcatttggatttttaaggcgttgtaactacatgtatgatgatg |
322 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45708108 |
aaacatttatcctttagaatatcttttaggctcatttgaatttttaaggcgttgtaactacatgtatgatgatg |
45708035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 45708395 - 45708341
Alignment:
| Q |
1 |
atgctaccatcattgatgtaatgacctcaacacctcagaataatctactccttat |
55 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45708395 |
atgctaccatcattgatgtaatgatctcaacacctcagaataatctactccttat |
45708341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University