View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_high_25 (Length: 318)
Name: NF21266_high_25
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 302
Target Start/End: Original strand, 1357867 - 1358159
Alignment:
| Q |
16 |
accgagaccggtacatatgattacgttcaattatgtcatttacttgctaagtgtcagtgtcgtgtctaattcaattatgtcatctacttaaattgctatg |
115 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1357867 |
accgagaccggtacatgtgattgctttcaattatgtcatttacttgctaagtgtcagtgtcgtgtccgattcaattatgtcatctacttaaattgctatg |
1357966 |
T |
 |
| Q |
116 |
tgtctgtgtcgtgtccggtgtca------gtgtca-atacttaaccaagaaatgatataattgcagagactaaaatcataattataaattcatcaataat |
208 |
Q |
| |
|
|||| ||||||||||| |||||| |||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357967 |
tgtcggtgtcgtgtccagtgtcattgttagtgtcagatacgtaaccaagaa-tgatataattgcagagactaaaatcataattataaattcatcaataat |
1358065 |
T |
 |
| Q |
209 |
aaaataggaataagcaatgacgatactgttgcaatgagatcgacgtgaggatcatcaataggcttaagcatgattcttgtaacgaaatgcttcg |
302 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1358066 |
aaaataggaataagaaatgacgatactgttgcaatgagatcgacgtgaggatcatcaataggcttaagcatgattcttgtaacgaaatgcttcg |
1358159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 284
Target Start/End: Original strand, 1357495 - 1357558
Alignment:
| Q |
221 |
agcaatgacgatactgttgcaatgagatcgacgtgaggatcatcaataggcttaagcatgattc |
284 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| || || || |||||||||| |
|
|
| T |
1357495 |
agcaatgaggatcctgttgccatgagatcgacgtgaggatcatcgattggtttgagcatgattc |
1357558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University