View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_high_28 (Length: 306)
Name: NF21266_high_28
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 32267666 - 32267390
Alignment:
| Q |
18 |
acattgaaacgttgggtcatggtaaaatttcagtcctaaaatttgatgtgtcatttattggatgtcatttggtttgtacctaacaaaggtgtgatcgnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32267666 |
acattgaaacgttgggtcatggtaaaatttcagtcctaaaatttgatgtgtcatttattggatgtcatttggttggtacctaacaaaggtgtgatcgttt |
32267567 |
T |
 |
| Q |
118 |
nnnnn--aatataagaaaccactttattaagaagaatgcaagacatattcaatctcaaattaaaccagtgtgcagactttatagtcaaactaggagcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
32267566 |
tttttttaatataagaaaccactttattaagaagaatgcaagacatattcaatctcaaattaaaccggtgtgcatactttgtagccaaactaggagcttc |
32267467 |
T |
 |
| Q |
216 |
aaatgatgatgatctgactattcactcc--caccctctagagggccttcttcctttgctacaatcggatgaattatg |
290 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| || ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32267466 |
aaatgatgatgatctgactaatcactcccacaccatccagagggccttcttcctttgctgcaatcggatgaattatg |
32267390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 14446632 - 14446684
Alignment:
| Q |
18 |
acattgaaacgttgggtcatggtaaaatttcagtcctaaaatttgatgtgtca |
70 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14446632 |
acattcaaacgttggaccatggtaaaatttcagtccttcaatttgaggtgtca |
14446684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 32271780 - 32271744
Alignment:
| Q |
18 |
acattgaaacgttgggtcatggtaaaatttcagtcct |
54 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
32271780 |
acattcaaacgttgggccatggtaaaatttcagtcct |
32271744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 211 - 288
Target Start/End: Original strand, 9452375 - 9452452
Alignment:
| Q |
211 |
gcttcaaatgatgatgatctgactattcactcccaccctctagagggccttcttcctttgctacaatcggatgaatta |
288 |
Q |
| |
|
||||| ||||||| ||||||| |||||||||||||||| |||||| | |||||||||| ||||||||||||||| |
|
|
| T |
9452375 |
gcttctaatgatgttgatctgttaattcactcccaccctccagaggggttcattcctttgctgcaatcggatgaatta |
9452452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 288
Target Start/End: Complemental strand, 40736642 - 40736562
Alignment:
| Q |
208 |
ggagcttcaaatgatgatgatctgactattcactcccaccctctagagggccttcttcctttgctacaatcggatgaatta |
288 |
Q |
| |
|
|||||||| ||||||| |||| || |||||||||||||||| ||| || || ||||||||||| || |||||||||||| |
|
|
| T |
40736642 |
ggagcttctaatgatgttgatttgttaattcactcccaccctccagatgggctccttcctttgctgcagtcggatgaatta |
40736562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University