View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_high_32 (Length: 287)
Name: NF21266_high_32
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_high_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 53 - 278
Target Start/End: Complemental strand, 6711778 - 6711553
Alignment:
| Q |
53 |
gaaaccatcatagaaggtttcaactttctcttaatcacaattgattcttcaataacattaaaatcatttcttggtccttcactatgatgatcttgttgaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711778 |
gaaaccatcatagaaggtttcaactttctcttaatcacaattgattcttcaataacattaaaatcatttcttggtccttcactatgatgatcttgttgaa |
6711679 |
T |
|
| Q |
153 |
aagcttgaagattattttcatattttttcttcaattctacttcttgcaccccccttatgtttgagatcttgttactagttctttcccttgctcttgctct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711678 |
aagcttgaagattattttcatattttttcttcaattctacttcttgcaccccccttatgtttgagatcttgttactagttctttcccttgctcttgctct |
6711579 |
T |
|
| Q |
253 |
tgctttttcccttgactccttcatct |
278 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6711578 |
tgctttttcccttgactccttcatct |
6711553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University