View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_high_48 (Length: 239)
Name: NF21266_high_48
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_high_48 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 4413324 - 4413529
Alignment:
| Q |
20 |
taaggttgtgttttttatgaatggtttaacgattttgttgaaaatcaaaaatgggtttttgaatgtaagatcctagaatcgtaaaattggtagaatcaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4413324 |
taaggttgtgttttttatgaatggtttaaagattttgttgaaaatcaaaaatgggtttttgaatgtaagatcgtagaatcgtaaaattggtagaatcaat |
4413423 |
T |
|
| Q |
120 |
gagattttacgtt-aaaaaagggnnnnnnnngaccctgttgcnnnnnnnntgatcctttttaggtttatatagaaaccataaacctaatttgtgttttag |
218 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4413424 |
gagattttacgttaaaaaaagggtttttttttaccctgttgcaaataaaatgatcctttttaggtttatatagaaaccgtaaacctaatttgtgttttag |
4413523 |
T |
|
| Q |
219 |
cttcat |
224 |
Q |
| |
|
|||||| |
|
|
| T |
4413524 |
cttcat |
4413529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University