View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21266_high_51 (Length: 236)

Name: NF21266_high_51
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21266_high_51
NF21266_high_51
[»] chr5 (1 HSPs)
chr5 (1-220)||(35294471-35294690)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 35294471 - 35294690
Alignment:
1 atgtgataagaaaaataatcatttagtttgtggcttgtcttttcgagcaaagtgtcttttagggaagcaaaagcatatcaatctctttcgtttactcaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35294471 atgtgataagaaaaataatcatttagtttgtggcttgtcttttcgagcaaagtgtcttttagggaagcaaaagcatatcaatctctttcgtttactcaat 35294570  T
101 taattgggcaacacagccgtttaacgatgaggataaaaatgtctatcacccctnnnnnnntgtgtatatgtaatatcaatccctttcttttagagattgg 200  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||       ||||||||||||||||||||||||||||||||| ||||||    
35294571 taattgggcaacacagccgtttaacgatgaggataaaagtgtctatcacccctaaaaaaatgtgtatatgtaatatcaatccctttcttttagcgattgg 35294670  T
201 tatgaaatatgaatcatgat 220  Q
    ||||||||||||||||||||    
35294671 tatgaaatatgaatcatgat 35294690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University