View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_10 (Length: 465)
Name: NF21266_low_10
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 20 - 457
Target Start/End: Original strand, 4413324 - 4413762
Alignment:
| Q |
20 |
taaggttgtgttttttatgaatggtttaacgattttgttgaaaatcaaaaatgggtttttgaatgtaagatcctagaatcgtaaaattggtagaatcaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4413324 |
taaggttgtgttttttatgaatggtttaaagattttgttgaaaatcaaaaatgggtttttgaatgtaagatcgtagaatcgtaaaattggtagaatcaat |
4413423 |
T |
|
| Q |
120 |
gagattttacgttaaaaaa-gggnnnnnnnngaccctgttgcnnnnnnnntgatcctttttaggtttatatagaaaccataaacctaatttgtgttttag |
218 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4413424 |
gagattttacgttaaaaaaagggtttttttttaccctgttgcaaataaaatgatcctttttaggtttatatagaaaccgtaaacctaatttgtgttttag |
4413523 |
T |
|
| Q |
219 |
cttcatttcattgagtttctctctcttggtctctttctgcctaaacatgagttcaaagccaacctctactaaccctaaaagctgnnnnnnnagggtttga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4413524 |
cttcatttcattgagtttctctctcttggtctctttctgcctaaacatgagttcaaagccaacctctactaaccctaaaagctgtttttttagggtttga |
4413623 |
T |
|
| Q |
319 |
attgataccctaaacctaatttctggtttagcttcattctgttctctctctctgccctagaaatgagttcaaatgcaaattctgttgattctgctgctgc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4413624 |
attgataccctaaacctaatttctggtttagcttcattctgttctctctctctgccctaaaaatgagttcaaatgcaaactctgttgattctgctgctgc |
4413723 |
T |
|
| Q |
419 |
tgctagccctagtggtttattttctggaaatgatgatgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4413724 |
tgctagccctagtggtttattttctggaaaagatgatgt |
4413762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University