View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_19 (Length: 373)
Name: NF21266_low_19
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 268
Target Start/End: Complemental strand, 36526441 - 36526195
Alignment:
| Q |
20 |
aggagaacatatgcttcnnnnnnncttttataatagaacatatgtcattgattgtgagaataatttctcatgtgtttttctctctctcttagacatgctg |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||| | | | ||||||||||||| |
|
|
| T |
36526441 |
aggagaacatatgcttctttttttcttttataatagaacatatgccattgattgtgagaataatttctcatgttttttttttttttacttagacatgctg |
36526342 |
T |
 |
| Q |
120 |
atcctttgcagttgagttatgagcttcaaatggtagcaacactgtggcaacgtaaagatttgattgatcctagaatctaacaatacaggttattttttgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526341 |
atcctttgcagttgagttatgagcttcaaatggtagcaac--tgtggcaacgtaaagatttgattgatcctagaatctaacaatacaggttattttttgg |
36526244 |
T |
 |
| Q |
220 |
atgtcgttagtttgatatttcctcttgctttagtcatagtaattacatg |
268 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36526243 |
atgtcgttagtttggtatttcctcttgctttagtcatagtaattacatg |
36526195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 309 - 363
Target Start/End: Complemental strand, 36526154 - 36526100
Alignment:
| Q |
309 |
acaggaatagcattgctgcaagtatggtattgttggtaagaattgctttcctttg |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526154 |
acaggaatagcattgctgcaagtatggtattgttggtaagaattgctttcctttg |
36526100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University