View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_24 (Length: 336)
Name: NF21266_low_24
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 47033789 - 47033470
Alignment:
| Q |
18 |
aacctaaccaattatattactcacatgcaagtaaagatctcgtgcaagattgcacggatgtggnnnnnnnnntggcgggaaaacaccgccaggtgccaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47033789 |
aacctaaccaattatattactcacatacaagtaaagatctcgtgcaagattgcacggatgtggaaaaaaaa-tggcgggaaaacaccgccaggtgccaag |
47033691 |
T |
 |
| Q |
118 |
tgttattagcataaaactttttcttcaaaattaaaattacggtgaatcttgcaaaacaggattacaatatggaatatccaaccggaaagttgggctgatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47033690 |
tgttattagcataaaactttttcttcaaaattaaaattacggtgaatcttgcaaagtaggattacaatatggaatatccaaccggaaagttgggctgatt |
47033591 |
T |
 |
| Q |
218 |
caccttcaaattttagaaaatcaaagaaacaagttatcattttcacaatttcattcaccatt--gcacacctatactttctaaacatcaaaatagttcta |
315 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47033590 |
cacattcaaattttagaaaatcaaagaaataagttctcattttcacaatttcattcaccattaagcacacctatactttctaaacatcaaaatagttcta |
47033491 |
T |
 |
| Q |
316 |
tttgtttttcgagctcattac |
336 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47033490 |
tttgtttttcgagctcattac |
47033470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University