View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_44 (Length: 253)
Name: NF21266_low_44
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 31823752 - 31823938
Alignment:
| Q |
1 |
ttgacgaggaatggaggctcatatgaggttgtaatggtgagtggttgggtagttttgctatactctaaggtatttgtaatgtattggcggttgagctcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31823752 |
ttgacgaggaatggaggctcatatgaggttgtaatggtgagtggttgggtagttttgctatactctaaggtatttgtaatgtattggtggttgagctcgg |
31823851 |
T |
 |
| Q |
101 |
atgtgtgttagaaggattatgatatgcgtggagtttggggtttcaaaatgttgaacttcatattgactcgtgggttgtggttaatat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31823852 |
atgtgtgttagaaggattatgatatgcgtggagtttggggtttcgaaatgttgaacttcatattgactcgtgggttgtggttaatat |
31823938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 190 - 240
Target Start/End: Original strand, 31824041 - 31824091
Alignment:
| Q |
190 |
tcgtgaagccaatttgtacgttgaggctctttcaaattttgtttgcagtct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31824041 |
tcgtgaagccaatttgtacgttgaggctcttgcaaattttggttgcagtct |
31824091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University