View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_53 (Length: 239)
Name: NF21266_low_53
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 13871578 - 13871398
Alignment:
| Q |
41 |
ttggcttgccacaaactcttgtcagtatagccgtaggatgtaaaacaaacaaactattaatctctatctatgggaagagtaacatttgatgattcaacct |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
13871578 |
ttggcttgccacaaactcttgtcggtatagccgtaggatgtaaaacaaacaaactattaatct--atctatgggaagagtaacatttgatgattcaaact |
13871481 |
T |
|
| Q |
141 |
ctttaaagtgtattgaagagaatataatgcaaatgagccaatagtgtgacttatattccaggacttacggattactaacaaac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13871480 |
ctttaaagtgtattgaagagaatataatgcaaatgtgccaatagtgtgacttatattccaggacttacggattactaacaaac |
13871398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University