View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21266_low_55 (Length: 236)

Name: NF21266_low_55
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21266_low_55
NF21266_low_55
[»] chr4 (1 HSPs)
chr4 (1-221)||(9678889-9679109)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 9679109 - 9678889
Alignment:
1 ccacagttgcgttgtgatctttaatattgtggaggattagtcgaaatgtgattaacgtagtcttaactacgttgacttcgcgtagaaaaaacacacattt 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| | ||||||||||||| |||||||    
9679109 ccacacttgcgttgtgatctttaatattgtggaggattagtcgaagtgtggttaacgtagtcttaactacgttgacattgcgtagaaaaaactcacattt 9679010  T
101 atatgcgataaacaatattgactgttaatcttgagatcgaagattaccaaataacaaaatcagtttcaaacgatctttatcaacggttgagattgaaaac 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||    
9679009 atatgcgataaacaatattgactgttaatcttgagatcgaagattaccaaataacaaaattagtttcaaacgatctttatcaatggttgagattgaaaac 9678910  T
201 tatgtgatgtagtactagttt 221  Q
    |||||||||||||||||||||    
9678909 tatgtgatgtagtactagttt 9678889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University