View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_55 (Length: 236)
Name: NF21266_low_55
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 9679109 - 9678889
Alignment:
| Q |
1 |
ccacagttgcgttgtgatctttaatattgtggaggattagtcgaaatgtgattaacgtagtcttaactacgttgacttcgcgtagaaaaaacacacattt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
9679109 |
ccacacttgcgttgtgatctttaatattgtggaggattagtcgaagtgtggttaacgtagtcttaactacgttgacattgcgtagaaaaaactcacattt |
9679010 |
T |
|
| Q |
101 |
atatgcgataaacaatattgactgttaatcttgagatcgaagattaccaaataacaaaatcagtttcaaacgatctttatcaacggttgagattgaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9679009 |
atatgcgataaacaatattgactgttaatcttgagatcgaagattaccaaataacaaaattagtttcaaacgatctttatcaatggttgagattgaaaac |
9678910 |
T |
|
| Q |
201 |
tatgtgatgtagtactagttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9678909 |
tatgtgatgtagtactagttt |
9678889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University