View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21266_low_56 (Length: 236)
Name: NF21266_low_56
Description: NF21266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21266_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 35294471 - 35294690
Alignment:
| Q |
1 |
atgtgataagaaaaataatcatttagtttgtggcttgtcttttcgagcaaagtgtcttttagggaagcaaaagcatatcaatctctttcgtttactcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294471 |
atgtgataagaaaaataatcatttagtttgtggcttgtcttttcgagcaaagtgtcttttagggaagcaaaagcatatcaatctctttcgtttactcaat |
35294570 |
T |
|
| Q |
101 |
taattgggcaacacagccgtttaacgatgaggataaaaatgtctatcacccctnnnnnnntgtgtatatgtaatatcaatccctttcttttagagattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35294571 |
taattgggcaacacagccgtttaacgatgaggataaaagtgtctatcacccctaaaaaaatgtgtatatgtaatatcaatccctttcttttagcgattgg |
35294670 |
T |
|
| Q |
201 |
tatgaaatatgaatcatgat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35294671 |
tatgaaatatgaatcatgat |
35294690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University