View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21268_low_7 (Length: 240)
Name: NF21268_low_7
Description: NF21268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21268_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 44707981 - 44708193
Alignment:
| Q |
18 |
gttattttatccaatacttataatttcgattaccattatgcattcaannnnnnnn-ctcgaaatatttaatccacaagaaaatttgcgaacattaagttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44707981 |
gttattttatccaatacttataatttcgattaccattatgcattcaatttttttttctcgaaatatttaatccacaagaaaatttgtgaacattaagttg |
44708080 |
T |
|
| Q |
117 |
gctgagttcattgactaatgcggttcacttgttggttgtcttcccttctagtttgaagacaaaacgagaagtagaaaaatcccaacctcaagcaaacgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708081 |
gctgagttcattgactaatgcggttcacttgttggttctcttcccttctagtttgaagacaaaacgagaagtagaaaaatcccaacctcaagcaaacgtt |
44708180 |
T |
|
| Q |
217 |
tgtataatttcta |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44708181 |
tgtataatttcta |
44708193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University