View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21269_high_20 (Length: 323)
Name: NF21269_high_20
Description: NF21269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21269_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 225
Target Start/End: Complemental strand, 20775414 - 20775197
Alignment:
| Q |
8 |
tgagatgaacaaacaagcctaagttggcaagaaaggcactcttccaattctattttcagtcagtacgccttggattttttctggtagctggcgtcttata |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20775414 |
tgagaagaacaaacaagcctaagttggcaagaaaggcactcttccaattctattttcagtcagtacgccttggatttttactggtagctggcgtcttata |
20775315 |
T |
 |
| Q |
108 |
tgcttcagtttctaactttgaatttccaaaatttctatgatgattaatatagagacctctcaagttgttcaaccttctaaatttaatctataaaacaatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20775314 |
tgcttcagtttctaactttgaatttccaaaatttctatgatgattaatatagagacctctcaagttgttcaaccttctaaatttaatctataaaacaaga |
20775215 |
T |
 |
| Q |
208 |
atcttgttaatcagtgtt |
225 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
20775214 |
gtcttgttagtcagtgtt |
20775197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University